![]() ![]() AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCIGGCACGACAGGITTCC CGACIGGAAAGCGGGCAGTGAGCGCMACGCAATTAATGEGAGTTAGCTCACTCATTAGGCACCCCAGGCITTA CACTITATGCITCCGGCTCGTATGTTGTGTGGAR AGCGGATAACAATTTCACACAGGNANCAGCTATG ACCATGATTACGCCAAGCTATTTAGGEGACACT GAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCT CGGATCCACTAGTAACGOC GTGCTGG CAGATATCC CACACTGGCGGCCGCTCGNGCA TGCATCEAGAGGGOCCAATTCGCCCTATAG GAGTCGTATTACAATTCACIGGCCGTCGETTTACAACGTCGT GACTGGGAAAACCCTGGCGT TTAAT cccc GCTGGCGTAATA GCGAAGAGGCCCGCACCGATCGCCCIICCCAAC GCGCAGCCTATACGTACGGCAGITTMAGGTTTACAC CTATAMAAGAGAGAGCCGTT. Glenn Cameron Georgia Institute of Technology has a bunch of intuitive DNA cloning simulation tools you can use for free. Remember the more facts you can discern from the sequence the more points you get. It has limited analytical capabilites compared to Serial Cloner but is very useful to generate clearly laid out plasmid maps and its very straight forward to use. For example, your sequence analysis can contain the location of enzyme digestion sites, the number and size of any open reading frames, the identity of any sequence elements and genes and possibly a map of the DNA with the sequence elements identified. Serial Cloner Primer designing tool Primer3web version 4.1.0 Genefisher2 PrimerExplorer Description This primer analysis software is useful to design. Points will be awarded based on how extensive your interpretation is. ![]() Characterize the sequence using Serial Cloner or any other sequence analysis software you chose.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |