![]() Serve immediately, sprinkling each salad with a little coarsely grated Parmesan cheese. Place Swiss chard in a large bowl add dressing and toss to coat.Slowly whisk in oil to make a creamy dressing, stir finely grated cheese, and set aside. Whisk lemon juice, mayonnaise, half of the reserved garlic (save remaining garlic for another use) Worcestershire, a pinch of salt, and a few grinds of pepper in a small bowl.Return croutons to bowl and set aside to cool while preparing salad. Add bread cubes to hot skillet and toast, turning the cubes and shaking the pan often, until crisp and golden brown, 5 to 7 minutes.Drizzle garlic oil evenly over bread, along with big pinch of salt toss to coat. Heat a 10-inch skillet over medium heat.Strain garlic from oil through a fine-mesh strainer reserve garlic. Combine tofu, lemon juice, miso, vinegar, mustard, garlic, pepper and 1/4 cup water in a blender and pure until smooth. Continue to process so that garlic releases its flavor into the oil, about 30 seconds. ![]() Scrape down sides of bowl or canister and add olive oil through feeder tube. Mince garlic cloves in a food processor or blender.Now this is truly food worth celebrating. How winning is that?Įven better, they have been so successful they’re in the process of rolling out similar programs nationwide. Since starting VSAT (Veterans Sustainable Agriculture Training) in 2007, they have trained over 100 veterans in sustainable agriculture, creating more jobs for veterans and more farmers for America. In addition to being the kind of farmers we’d all like to buy our produce from, Colin and Karen started a training program for transitioning veterans in need of skills and employment. While Colin was serving as a rifleman in the United States Marine Corps, he and Karen managed to save a neglected avocado farm and turn it into robust small-scale, organic farm which now grows basil, kale, avocadoes, and chard to local markets – including Whole Foods. At our Friday night “Love Local” themed dinner the owners of Archi’s Acres, Colin and Karen Archipley, shared with us a brief history of their farm. Place the dressing in the fridge, it will thicken up in a few hours.A few weeks ago at the Big Traveling Potluck, we served this Swiss Chard Caesar Salad Mom developed for Whole Foods Market using Archi’s Acres Swiss Chard. So, if you have another kind of blender you will need to blend for a longer period of time until smooth. Easy PreparationĪdd all the Caesar salad dressing ingredients into a high speed blender (Vitamix) and blend on high for a couple minutes. ![]() In addition, you can also speed up the process by heating up some water then place the nuts in the warm water for a minute or so, then drain. When you need to use the cashews take out a portion for your recipe and let them defrost for 15 minutes. Once frozen you can take them off the sheet and place in a freezer bag for storage. And every month or so, I soak a batch of raw cashews (1-2 lbs) in water overnight, then dry them in a colander, spread them out onto a baking sheet, then place the baking sheet in the freezer overnight. ![]() To make this easy I usually keep a stash of soaked cashews in my freezer. The garlic and capers add to the flavor and the rest of the ingredients: almond milk, EVOO, Dijon, Worcestershire sauce, lemon juice and spices should already be in your pantry. The cashews are responsible for the creaminess in this dressing. I played around with the ingredients for a while and finally…I believe I totally nailed it! Ingredients You Can Easily Find I was inspired by a Caesar salad from Erewhon Market in Los Angeles. Eagle is the common name for the golden eagle, bald eagle, and other birds of prey in the family Accipitridae. I love a rich creamy Caesar dressing and this one does not disappoint. Crave-Worthy Plant-Based Caesar Salad Dressing
0 Comments
![]() After his death in 130 BC, he was succeeded by his wife Agathocleia, perhaps the daughter of Agathocles, who ruled as regent for his son Strato I. Menander was also a patron of Buddhism, and his conversations with the Buddhist sage Nagasena are recorded in the important Buddhist work, the Milinda Panha ("The Questions of King Milinda" panha meaning "question" in Pali). Large numbers of Menander’s coins have been unearthed, attesting to both the flourishing commerce and longevity of his realm. Ancient Indian writers indicate that he launched expeditions southward into Rajasthan and as far east down the Ganges River Valley as Pataliputra ( Patna), and the Greek geographer Strabo wrote that he "conquered more tribes than Alexander the Great." After re-conquering the Punjab he established an empire which stretched from the Kabul River valley in the west to the Ravi River in the east, and from the Swat River valley in the north to Arachosia (the Helmand Province). Menander might have initially been a king of Bactria. Menander is noted for having become a patron and may convert to Greco-Buddhism and he is widely regarded as the greatest of the Indo-Greek kings. 165/155 –130 BC) who administered a large territory in the Northwestern regions of the Indian Subcontinent from his capital at Sagala. 'Menander the Saviour' Pali: Milinda sometimes called Menander the Great ) was a Greco-Bactrian and later Indo-Greek King (reigned c. Menander I Soter ( Ancient Greek: Μένανδρος Σωτήρ, romanized: Ménandros Sōtḗr, lit. ![]() He would team with Rodriguez again for the stylish noir thriller "Sin City" (2005). Outside of the "Lord of the Rings" films, he appeared in Robert Rodriguez's "Spy Kids 3-D: Game Over" (2003) and with Jim Carrey and Kate Winslet in "Eternal Sunshine of the Spotless Mind" (2004). Wood went on to star in the two other legs of the trilogy "The Two Towers" (2002) and "The Return of the King" (2003), the latter of which earned 11 Academy Awards. The film was a hit with audiences and critics alike. Tolkien's hobbit hero Frodo Baggins for "The Lord of the Rings: The Fellowship of the Rings" (2001). His transition to adulthood was aided significantly when Peter Jackson cast the actor as J.R.R. He joined an all-star cast for the big budget disaster film "Deep Impact" (1998), but then started moving into more mature roles with an appearance in James Toback's indie drama "Black & White" (1999). While the actor's main recognition came from the big screen, he did make occasional TV appearances on shows like "Frasier" (NBC, 1993-2004) and "The Wonderful World of Disney" (ABC, 1997-). He then joined fellow young stars Tobey Maguire and Christina Ricci in Ang Lee's family drama "The Ice Storm" (1997). He appeared as Kevin Costner's son in "The War" (1994) and starred alongside Paul Hogan in a big screen remake of the 1960s television show "Flipper" (1996). He joined Macaulay Caulkin for the thriller "The Good Son" (1993) and played the namesake character in Rob Reiner's fantasy "North" (1994). After starring in the Disney remake of "The Adventures of Huck Finn" (1993), Wood was firmly established as a screen actor. He went on to star with Mel Gibson and Jamie Lee Curtis in the J.J. His film roles quickly expanded with sizable parts in Barry Levinson's "Avalon" (1990), the Don Johnson-Melanie Griffith drama "Paradise" (1991), and Richard Donner's "Radio Flyer" (1992). He soon starred with JoBeth Williams and Tom Skerritt in the TV movie "Child in the Night" (CBS, 1990) as a young murder witness. He made his film debut with a small part in "Back to the Future II" (1989) and had a small supporting role in the Richard Gere drama "Internal Affairs" (1990). A native of Cedar Rapids, Iowa, he relocated to Los Angeles as a youngster in order to break into acting. “Look, any excuse to get to go to New Zealand to work on something, I am absolutely there.Elijah Wood found early fame as a child actor before becoming a lasting part of film history by playing Frodo Baggins in the acclaimed "Lord of the Rings" trilogy. “If there was a world where that made sense and was organic to what they’re doing, then yes,” he said at the time. In July 2020, Wood told IndieWire that he is “super fascinated” by the project and would “absolutely” cameo if asked. Many of the franchise’s original stars returned to reprise their roles.Ī Lord of the Rings TV series debuted on Amazon Prime Video in September 2022. Jackson went on to direct a prequel trilogy series between 20 based on The Hobbit, Tolkien’s children’s book that was the predecessor to Lord of the Rings. The Return of the King won all 11 nods it received, including Best Picture - a major achievement that allowed it to become the first fantasy film to succeed in that category. The franchise won 17 of the 30 Academy Award nominations it nabbed. We knew it would be special, but we didn’t know what was right around the next bend.” “The two months of prep before we started shooting when we got to know each other, and had this buzz of excitement about the adventure we were going on. Being in New Zealand,” Wood told Cinema Blend in 2016 of his experience working on the film series. “I think what sticks in my mind is largely what’s loomed in my mind since we finished, which is just the experience of having made it. Sir Ian McKellen (Gandalf), Orlando Bloom (Legolas), Viggo Mortensen (Aragorn), Sean Astin (Samwise Gamgee), Cate Blanchett (Galadriel) and Andy Serkis (Gollum) were among the film’s star-studded cast.Īfter the Peter Jackson-directed film went on to earn more than $888 million worldwide, two final installments followed: The Lord of the Rings: The Two Towers (2002) and The Lord of the Rings: The Return of the King (2003). By doing so, he will help to save Middle-earth from the Dark Lord Sauron. Like Tolkien’s books, the early aughts film followed a hobbit named Frodo Baggins ( Elijah Wood) as he embarks upon a journey with others to destroy the One Ring. Tolkien’s fantasy series The Lord of the Rings made its big screen debut in 2001 with The Lord of the Rings: The Fellowship of the Ring - and the rest is history. Heading back to Middle-earth! Author J.R.R. ‘Lord of the Rings’ Cast: Where Are They Now? ![]() Also at the time of video editing I will know much better how to do an aesthetic movement because I will also be able to consider the adjacent clips then. Personally, I prefer to export the full frame and do any ken burns animations later in video editing, because video editors do that smoother. My recommendation would be to do very simple and slow animations only (too much crop movement will distract the viewer anyway) if you really want to do them in LRTimelapse. The warning happens, if the exporter finds that kind of rounding errors or other anomalies with the crop, to prevent choppy results or encoder errors due different aspect ratios.įixing it like you do might work, but more likely it will just get rid of the warning and still lead to choppy videos. This also might lead to skewed crops in the transitions. Every decent video editor will crop on a subpixel basis to get the smoothest animation, this is just not possible with Lightroom.Īnother thing you should be careful with is to not place any of the crops on keyframes directly on the edge of the frame. LRTimelapse tries the best to calculate those animations, but as I always said, Lightroom is not really designed for this kind of things. I think the problem might happen in some very specific cases, where the motion calculation leads to slightly different crop aspects ratios due to Lightroom always cropping to full pixels. Hi Steve, thanks for sharing your findings. So it seems to me the issue is occurring in LR Timelapse. In my current project my first frame motion was on index 119, but the crop aspect ratio occurred on index 8, which was static from the first frame, and as mentioned above the entire project was initially synced with the crop and aspect ratio of the first frame. Once this is done LR no longer gives me the different crop aspect ratio found error. What I've found as a simple solution is to select the first frame, then all frames and sync just the aspect ratio, (see attached screen shot) not the entire crop as that will reposition all the frames to the same crop location and size as the first frame, which will change any size and frame motion. I think this is something that is occurring in LR Timelapse, not LR. After Reading the metadata back into LR I'm ready to export, but I get an error that there are different crop aspect ratios (see attached screen shot). I then go back to LR Timelapse and go through the second row on the Visual Workflow. I then select the frame where I want motion to start, giving it a 5-star rating the last frame I want motion to stop, give it a 5-start rating and any frames in between these two are then adjusted accordingly and given a 5-star rating where sizing or motion changes. ![]() My starting point is to select first frame and set it's aspect ratio to 16x9 then sync all frames in the time lapse to that crop (only sync the crop settings). When I want to have some frame motion in my time lapse I know to use 5-stars in LR and to set my crop to 16x9, the same as I will use for output. ![]() To do that, go to Sequence at the top of your screen and then click on Sequence Settings. I don't know why/how it occurs but a solution seems fairly simple so thought I'd share the problem and the solution. To crop aspect ratio in Premiere Pro, all you have to do is change the Sequence settings. This post was last modified:, 01:19 by Steve. ![]() It might not look the same as freeze-dried candy made in a freeze dryer, but that's because the entire process is different, and the dry ice method is just to emulate the results of a freeze fryer. Then let the candy sit for 48 hours and you’ll have your very own freeze dried candy. Make sure not to seal the cooler, as the pressure from the dry ice will build up and it is likely to make the cooler explode. ![]() The dry ice should be all around your candy, so it should be below it, at the sides of the freezer bag, and covering the freezer bag. After a few hours when they are completely frozen, take them out of the freezer, and place them into a cooler full of dry ice. This will help solidify them and help the candy keep its shape throughout the procedure. You don’t have to complete this step for hard candy, but you do for your other favourite candies. First, cut up your candy into small pieces, as it will reduce the time it will take to freeze it. The material you will need will be the candy of your choice, dry ice, a cooler, a freezer, and a freezer bag. Put the freezer bag in a cooler with dry ice.Make sure the candy is in bite-size pieces.So you want to freeze dry candy at home without buying an actual freeze dryer? Well, you came to the right place, because here at the Sweet Lyfe, we got your answer, Dry Ice! Yes, frozen nitrogen is going to be your best friend in this process, as it's going to do the heavy lifting, making sure you achieve the closest results you can get without having your own freeze dryer. I wanted to “win weeks” rather than go stud TE that in my opinion and review of ADP would cost me at QB or WR. With the flex spot open to the WR, the ability to Superflex another and the longevity of the position, this position is really the focus of my team build.īe excellent here and at QB because each will theoretically last a long time in the NFL.īe better than average week to week at TE and don’t look to make it the flex spot. With the 17-game schedule and possibility of an 18-game schedule, the attrition rate could get even worse and life span even shorter. I just don’t see the long-term benefit of trying to get a workhorse when the jobs become more and more split each year. Some of the guys to be selected in this start up draft will fill some of the roles in each city as place holders for 2023 rookies. This made the choice of a young veteran QB a priority, but not early in the draft. Sleeper teams before drafting I looked at: NY Giants, NY Jets, Minnesota, Philadelphia, New Orleans. At a minimum I see the following as open spots moving into 2023: Atlanta, Carolina, Detroit, Houston, Seattle, Tampa, Tennessee and Washington. Retain a 1 st round pick with an eye towards trading it in season if I have a shot or trading for more 1’s if the team crashes and burns in 2022.īe dynamic at the QB spot.Find a 3 rd QB that can last a few years bouncing around. Avoid the veteran “win now” as much as possible - even if it means the “look” of the team is less than other owners. Here's Lou's recap of a recently completed FFPC Superflex dynasty startup draft.īuild a team of younger veteran players that have proven they can play in the NFL and still have what appears to be 3-5 years of play left. Lou was part of the trio that started the FFPC. He's also won multiple high-stakes leagues at Masters Fantasy Football. ![]() ![]() Lou Tranquilli has top-35 finishes in the WCOFF, NFFC and FFPC Main Events. ![]() ![]() AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCIGGCACGACAGGITTCC CGACIGGAAAGCGGGCAGTGAGCGCMACGCAATTAATGEGAGTTAGCTCACTCATTAGGCACCCCAGGCITTA CACTITATGCITCCGGCTCGTATGTTGTGTGGAR AGCGGATAACAATTTCACACAGGNANCAGCTATG ACCATGATTACGCCAAGCTATTTAGGEGACACT GAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCT CGGATCCACTAGTAACGOC GTGCTGG CAGATATCC CACACTGGCGGCCGCTCGNGCA TGCATCEAGAGGGOCCAATTCGCCCTATAG GAGTCGTATTACAATTCACIGGCCGTCGETTTACAACGTCGT GACTGGGAAAACCCTGGCGT TTAAT cccc GCTGGCGTAATA GCGAAGAGGCCCGCACCGATCGCCCIICCCAAC GCGCAGCCTATACGTACGGCAGITTMAGGTTTACAC CTATAMAAGAGAGAGCCGTT. Glenn Cameron Georgia Institute of Technology has a bunch of intuitive DNA cloning simulation tools you can use for free. Remember the more facts you can discern from the sequence the more points you get. It has limited analytical capabilites compared to Serial Cloner but is very useful to generate clearly laid out plasmid maps and its very straight forward to use. For example, your sequence analysis can contain the location of enzyme digestion sites, the number and size of any open reading frames, the identity of any sequence elements and genes and possibly a map of the DNA with the sequence elements identified. Serial Cloner Primer designing tool Primer3web version 4.1.0 Genefisher2 PrimerExplorer Description This primer analysis software is useful to design. Points will be awarded based on how extensive your interpretation is. ![]() Characterize the sequence using Serial Cloner or any other sequence analysis software you chose. ![]() Additionally, the prayer shawl that frequently hangs above a chuppah is referred to as a tallis (Yiddish spelling) or tallit (Hebrew spelling).Hired ArcDivine. We strive to be more than a behind-the-scenes planner we want you to come to us because you know. Our team is dedicated to making your planning process and day-of the very best it can be, and we know that customization is crucial to a day overflowing with meaning and memories. While chuppah is the spelling you'll most commonly see in use, chuppa and huppah are alternate spellings that refer to the same four-posted ceremony structure traditionally used at Jewish wedding ceremonies. How do you approach weddings We are a luxury wedding service that values each couple with utmost care and respect. With the first stage being kiddushin during which the signing of a ketubah takes place. More specifically, the chuppah refers to the place where nissuin (or nesuin), the second stage of a Jewish marriage ceremony, takes place. They were originally carried in by family members and held in place during the ceremony but that portion of the tradition is rarely carried out today as chuppahs have become far too elaborate to carry anymore." Since most ceremonies were originally held outdoors this structure was supposed to create a sacred space. ![]() "The chuppah is supposed to represent the couple's first home together. Rent wedding arches, chuppahs, decor and more. and boutonnieres to the centerpieces to the ceremony flowers, including the gorgeous chuppah. Wedding ceremony rentals for Beverly, Gloucester, Salem, Marblehead & the Boston North Shore area. The tent is very nice and Cal was great to work with. Our collection includes the finest seating, tables, bars, lighting and accessories encompassing a wide and varied style from South Beach Chic to Baroque gone Modern. Used in both indoor or outdoor ceremonies, wedding arches are becoming more and more popular every year. Luxe Event Rentals is a fresh and innovative boutique style rental company offering an exclusive line of luxury event furnishings and decor that go beyond standard rental items. ![]() Choose your draping style from any photo, all styles are mix and match. These structures are typically 7 feet tall and 3-4 feet wide. Choose your canopy style from sheer white to a talit 3. STUNNING CHUPPAHS FOR MODERN WEDDINGS SHIPPED EVERYWHERE IN THE U.S. Based in Los Angeles, We ship Nationwide across the US. It is usually required by the Rabbi that the opening between the four poles is covered," explains Laura Maddox, owner of Magnolia Celebrates. Choose your chuppah frame from the selection below including Maple, Cedar, Birch and Copper, or a Hand Held Chuppah 2. We offer Chuppah Rentals and Custom Design Chuppah. "A chuppah is a square ceremony space that has four poles and a top. Simple Chuppah Wedding Ceremony Inspirationįrequently Asked Questions Regarding Chuppahs What is a chuppah?Ĭhuppah is a Hebrew word whose English translation means "canopy" or "covering." Simply put, a chuppah is a wedding canopy that is part of Jewish tradition and is commonly incorporated in Jewish wedding ceremonies.Tropical Chuppah Ideas for a Jewish Wedding Ceremony.Our wedding arch are great for adding flowers, decors, draping and plants to match any colour or design theme you may have for your wedding. Since our rentals are do-it-yourself, you can rent a cheap chuppah for a fraction of the cost. They needed a wedding canopy land their local drape supplier was charging them over 1200. We have large selection of wedding arches including rustic arches, flower arches, round wedding arches and white birch arches. A floral company contacted us because their local vendor quoted them too much for a last-minute rental. ![]() We can dress it simply with basic fabric, or we can. Our chuppah and wedding arch structures are like blank canvases. From simple to extravagantwe can customize a chuppah to your specifications. We are your source for chuppah and wedding arch rentals in Philadelphia, Bucks and Montgomery counties. From structures built out of driftwood to wedding canopies covered in monstera leaves, the options are almost limitless when it comes to bringing a tropical vibe to your chuppah design. We rent wedding arches and wedding chuppahs for events in Toronto. Philadelphia Chuppah Rental & Arch Rental. Add-Ons : We rent the 10×10 acrylic stage (height is 10 inches) for 975.00. Modern Chuppah Rental in Chicago, wedding flowers, centerpiece rental, chair cover rentals, canopy rentals, wedding decoration rentals in chicago & suburbs. Floral Chuppah Ideas for a Jewish Wedding Ceremony Tropical Chuppah Ideas for a Jewish Wedding Ceremony. Price: 4-Hour Rental: 1,500 24-Hour Rental (most popular) 2,000. Call us today at (773) 865-6706 and let us know how we can help you have an incredibly beautiful, memorable and special event. ![]() ![]() Now is the time to become one of the Mugiwara Nakamas while you have fun in the world of One Piece, probably the most important manga of all time. This videogame is full of missions to complete, different game modes, and a neverending cast of characters that you can directly control. One Piece: Fighting Path is a fantastic action and adventure RPG that fantastically translates the world of Luffy and Co. The game stands out even more when you are in battle, thanks to the fluidity of the animation. Fighting Path has the original series dubbing and 3D graphics that look as if they've been taken from the anime itself. The technical aspect of this RPG is fantastic and is as good as any of the other anime-based games you may have seen on mobile devices. These are heroes that you can upgrade even more, thanks to the different objects and skills tree that lets you increase their strength in any area you want. What's more, there is an enormous group of characters that you can recruit as you go in the game's Story mode, or by using the gacha system to get an unstoppable team of characters. In One Piece: Fighting Path, each character has their own special attacks, so you will enjoy doing legendary techniques like Luffy's Gomu Gomu no Gatling, or Zoro's Shishi Sonson. This RPG uses the classic rock-paper-scissors system to decide which characters have advantages or disadvantages over others, so you have to create a balanced team of heroes that can face any adversity. ![]() You control a group of up to three characters, similar to other games that are based on anime: free control of the camera in the 3D scenes, moving with the joystick on the left of the screen, and action buttons on the right. This jus style char called WN-Zoro was created for MUGEN 1.1 by WolfStak and requires OpenGL. Luffy after he is saved from being executed at the Marine Base. The battles in this action RPG really immerse you in the One Piece world. Description - Roronoa Zoro is a fictional character in the anime One Piece, the first to join Monkey D. While you explore the One Piece world, you can start conversations with NPCs and other players, as well as look for objects in the environments or go on missions that require certain conditions. The action in One Piece: Fighting Path is divided into two different parts: scene exploration, whether it's on foot or a boat, and the real-time battles. All of this while you learn the basic concepts in the game and navigate through the East Blue. During the tutorial, you will meet Coby and fight against Lady Alvida's crew. Luffy on the day he leaves Foosha Village to embark on his dream of becoming the Pirate King. In this official One Piece videogame, you will relive the original story from the beginning: you start by controlling Monkey D. This is an RPG with real-time battles where you can control Luffy, Zoro, Nami and the rest of the characters from One Piece, the legendary manga created by Eiichiro Oda. Some character folders ( Game/ chars/) include Read-me file, in which you can find special moves and tips how to play more effectively.One Piece: Fighting Path is a roleplaying game where you can experience a thousand adventures alongside the most famous crew in the history of manga and anime.Extract the downloaded file (you can use WinRAR for example).You can fight with each other or cooperate and fight against characters controlled by computer AI. If you want to play with your friend, you'll be happy that most game modes have a multiplayer version. Unlike most Mugen games, there are no 2-versus-2 matches in which 4 characters are fighting at the same time. If you like team fights, Dragon Ball Z vs One Piece Mugen also includes several modes in which you'll take part in 2-versus-2 fights in the Tag Team system. A variation of this mode is Survival, where the fight is much more tactical because your health is not renewed after the fight. Arcade is the main mode in which you'll fight with random opponents from both franchises and the further you get it will be harder. The game has many modes in which you can test your skills. This is also a nice change as these days the majority of Mugen games is based on the JUS style, while here you will find graphics from games like Dragon Ball Z: Extreme Butoden and One Piece: Great Pirate Colosseum. The combat system is dynamic and gives a lot of joy. Stages are well-known places from both worlds, and although there aren't many of them, each of them is made at a high level. The Dragon Ball characters are known primarily from the powerful beam attacks, and the pirates from One Piece can perform deadly combos that will surprise many anime fighting game veterans. The struggles are really exciting because both sides use their own mechanics and their strength is based on different elements. You can choose from well-known heroes such as Goku, Vegeta, Piccolo, Gohan, as well as Luffy, Zoro, Nami, and Sanji. The game includes a total of 20 playable characters, 10 each from each franchise. But both Waterfox versions seemed fast and stable in actual browsing. The installed Waterfox clearly bested the portable version, which has been our experience with portable browsers. Both the installed and portable versions of Waterfox loaded quickly and were very similar to the others in performance, though none dethroned the reigning speed champ, Chrome. ![]() We ran numerous bandwidth speed tests on Waterfox Portable, the installed Waterfox, Firefox 18, Internet Explorer 9 32-bit and 64-bit, Opera, and Google Chrome. Other than that, Waterfox looks and behaves exactly like what it is, Firefox with some fancy tuning under the hood. If you open Waterfox and then open Firefox, the pages will open in Waterfox, and vice versa: If we had Firefox open, clicking the Waterfox icon opened a new page in Firefox (which is why we tried Waterfox with and without Firefox installed). Waterfox automatically imported our user data from our existing Firefox installation. The biggest difference most users will see between Firefox and Waterfox (installed or portable) is the deep-blue Waterfox Start button and blue logo. ![]() We also tried Waterfox Portable with and without standard Firefox installed. We pitted it against top-ranked browsers in two separate 64-bit Windows installations, Home Premium and Ultimate. The 64-bit Waterfox is also available in a fully portable version for users who prefer portable programs or who want a portable 64-bit Web browser for their USB drive. Of course, while your Internet connection's speed and reliability will have a much greater impact on your day-to-day browsing speed than your browser will, a 64-bit browser offers some advantages in 64-bit Windows, such as increased speed and improved stress handling. Waterfox takes advantage of a variety of speed-boosting technologies found in most current Intel CPUs and the latest AMD processors, too, such as SSE3, AVX, and Jemalloc. Many different Web browsers are built on Mozilla's open-source Firefox project, including Waterfox, a 64-bit version of Firefox. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |